EST 585881 is a singleton


Sequence

>585881 (1 EST) Length=296 GTTTTGCATTAGTTGCTCTGTGTTAAGTTAACATGGGAGAAGAAAAAAAAGAAAAGAAAGAAAAGAAAGAGAAAAAGGAG AAAAAAGAAAAAGAAGAGGATGCAGGAGCTCCAGCAGAGGATAAAAAAGAGACAGCGAGTAGTGGAGGCGGTGGTGGTGG TAAACGAGCTCAAAGAGCTACTTCAAATGTTTTTGGAATGTTCCCTCAGAATCAAATTCAAGAATTTAAGAGGCCTTTTC GTTGATCGTCCAAAACGTGATGGATTTTTGATATTGAGATTTAAAGATATGTATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 585881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858811377942U58063SMU58063Schistosoma mansoni adult worm Lambda ZAP II library


Date: 0:17:42 on Thu 23 Nov 117.