EST 585883 is a singleton


Sequence

>585883 (1 EST) Length=219 AAGTGCTCTTTACTACCACTTTCAAATCATGCTGATTTCGTTCCAGTTGTTCGCAAGTTATCTTCAGAACTGACTAAGTA TTCTGTTTCACATCGAGTCGATGAAAGATCTGTGGGTCCATCGGACGACGATATGCTCGTACAGATCAAATTGCTATTCC ATACGGAATTACTATCGACTTTGACACCCTGAATAAGTTACCTCCTTCAGCAACACTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 585883: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858831377944U58065SMU58065Schistosoma mansoni adult worm Lambda ZAP II library


Date: 3:45:53 on Sun 19 Nov 117.