EST 585885 is a singleton


Sequence

>585885 (1 EST) Length=207 AAGCTTTTTAGCTGGTGGGTTCGGTGGAGCATGTTGCATTGCAATCGGTCACCCTTTCGATACTATAAAGGTTCGACTTC AAACAATNCTCACGTAACATCAGGAGCAACGCTTATGTATTATGGGACTTTTGATTGTGTCAGGAAAACTGTGGCGGCTG ATGGCATCTTTGGACTTTATAAGGGGATGGGGGCACCATAGCTGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 585885: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858851377946U58067SMU58067Schistosoma mansoni adult worm Lambda ZAP II library


Date: 9:8:21 on Tue 21 Nov 117.