EST 585888 is a singleton


Sequence

>585888 (1 EST) Length=328 CAGAATTCCTGTTTAACTTCTATATAAATAATCATTATATCATCATATTAGAATAGTAATATTAACCATTAACCATGAAG CCATTATGTATATTATTGCTTACTTATTTCATTAATATTCTATGTGAATAGTATAATGGAAGATTCTATACACCAACTAC AACTTCAAAAGGATCTTCGAAGACGAAGTCAAACCAAATCTCTATCAGTGTATCGCATGCAGATCCGGTGTTGGACAAGC TAAGAATATAATTTTAAGTCCACCAACAAATAAGTCACTCGAGTGAGAGAATTCAAAATCTTTGCATGGAGACCGGCCCA TTTAACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 585888: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858881377949U58070SMU58070Schistosoma mansoni adult worm Lambda ZAP II library


Date: 22:32:7 on Tue 21 Nov 117.