EST 585889 is a singleton


Sequence

>585889 (1 EST) Length=281 TTTGGCTTCGCTTTAAACGTTGTTGTTATGCATGTTTCTATATCTTAGACTGTATTAAACTACTTGCACTCGCACAATTG GTTATTATATCCCTAATAATTTGTTGGATAACGTGTTTACATTTACTTTGATCTTCTAGTAGACCCCACTAAGATTCTAA ATTTCTGCTTATAAACGTGAACACAATTCCTGTACAATCTTTTCGTCTGACCAACTTTCAAGCAGTAAGAACTGATCAGA GGCAAANGGAGACGTTAGAGATATTTATTATTGGGGGGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 585889: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858891377950U58071SMU58071Schistosoma mansoni adult worm Lambda ZAP II library


Date: 12:48:36 on Sat 18 Nov 117.