EST 585890 is a singleton


Sequence

>585890 (1 EST) Length=234 GACAGTAGTGATAATACTTATAACATACAATTAACATTACATTATACTAATAATAAACCACATCCTGATGTAATGGTTTT TGTTGCTGTTAATATCTAGTCGAAATGTTTTACCTATAACTGAAATTAATGTTAGATTTGGTGTTGAAAAGCCTTTTAAA ATACGACCACTTATTGCATCTGGACAAAACCTTCCAGCTTATACAACTTTTCTACCACCTGCATCAATCGGCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 585890: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858901377951U58072SMU58072Schistosoma mansoni adult worm Lambda ZAP II library


Date: 20:52:2 on Wed 22 Nov 117.