EST 585892 is a singleton


Sequence

>585892 (1 EST) Length=129 AAGGCCATCTTCTTGGTCGTTTGGCCTCTGTGGTTGCCAAAACATTGCTCAATGGTCAGAAAGTAGTCGTAGTACGGTGC GAAAGCATTAATATATCAGGGATCTTTTTACCCGGAATAAATTGAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 585892: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858921377953U58074SMU58074Schistosoma mansoni adult worm Lambda ZAP II library


Date: 7:28:15 on Sat 18 Nov 117.