EST 585893 is a singleton


Sequence

>585893 (1 EST) Length=104 CGGCACGAGGAGAACTAGCCTCTTCGTAATGACTATCGTTTCACTGAGCCAGCAGCAGTGCTGGATATGTAACATGTGAT AAATAAAATGTTTGGGAATGCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 585893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858931377954U58075SMU58075Schistosoma mansoni adult worm Lambda ZAP II library


Date: 0:0:6 on Sun 19 Nov 117.