EST 585894 is a singleton


Sequence

>585894 (1 EST) Length=215 CGAAAATGAGATTAAACAAAAGCCCCATACAAAGACTCCCAAACCAATAGAATCTGATTATTCAATGGTCACTCGCGCCC CTGATGCCCCACGTCAACATAAAAGTAATAAAATGCCACTTCAAGAGTATTCAGAAAACTGGAAATTAGAGCCCCGAAAG CTGCAGTTTACACTTGTGAAAAAAGTGCGTCTTTCAGAATATCAGAGTNCNTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 585894: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858941377955U58076SMU58076Schistosoma mansoni adult worm Lambda ZAP II library


Date: 21:39:46 on Fri 17 Nov 117.