EST 585897 is a singleton


Sequence

>585897 (1 EST) Length=354 AGATAATATCCATCGAGGATTTAGTTGAACGGGAGAGGCAAGCTCTTGGACTAAATCAAACCAGAGTTACTTTACATACA TTTATGGAATGGAAGAAACGAAAGAGGCTTGAGAAAATCGAGAAACGACATGCTGATAAAGCGATGCGAGAAGCCAGTTA TAAACAAGGCCGTTCCGCAGGATAAGTGGTCGGGAGATCTTTGAGTTTGACCCAGCATTGGTTATGGAGGCGCTGGATGA TGATGAGACATCTGGAGTTGTTGACTCTAAAATTCGTGATGATGGAGAAAATGAATATGATGGTCCTTTTAGGGATATTG ACTTGAATATGTTTGGGATCGAGTTTTTGATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 585897: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858971377958U58079SMU58079Schistosoma mansoni adult worm Lambda ZAP II library


Date: 14:9:48 on Mon 20 Nov 117.