EST 585898 is a singleton


Sequence

>585898 (1 EST) Length=289 CATGGGATTTTAATCGACTAGAAGAGAATTTACGTAGTTATTTGGAATGCATTGAATCACAAAAGTCATCTAGAGTTATA AATGATTTCATCCAAACAGGTGAAATTCATTGTCCACCGACTGGTGAACGCTTTATTTTAGATATTTCTCAATATTATTC TCTTGATGACAAATCTAAAAGCCACCAACTCGTAAATGAAGATGTTGATGAGGGCGAAGATGATAATGCGATTGATGTGA TTAGTACACAAGTGGAAAACACCAAATAGAGAGACTTCATATTGAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 585898: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858981377959U58080SMU58080Schistosoma mansoni adult worm Lambda ZAP II library


Date: 13:35:28 on Fri 24 Nov 117.