EST 593101 is a singleton


Sequence

>593101 (1 EST) Length=333 GGGAGCGTCTGTTGTTGTGAATGATCTCGGAACCACTCAAGATGGATCATTTGCGAGATCTCTATCTGCGAATACGACTG TAGCAGAAATAAAATTTCACGGGGGCAAAGCGGTTCCAAATTTTGACAGTGTTGTGTATGGGCATAAAATCATCGAGGCA GCAATTGAACATTTCGGTCGAATAGGTAGGCAGTCGCCTTTATCATTTCTCCCAACAACAACCGGTTTACTCCTAAATGA TGCTGAGCTATCAGCAATTTTTGGATGCGATTTATCAGTGTATTGTTGGATTATGTTTCAGAGTGATAAATAATGGTCAT TTAGAAATAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 593101: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5931011397371W84914SWAMCA1060SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:16:43 on Mon 20 Nov 117.