EST 593117 is a singleton


Sequence

>593117 (1 EST) Length=78 ATATNTTCATCTTTTGATCGCTTTTGAATGGCGATAAGATTATCTGCGGGAGGTGCATCTGAGAGAGAAGTTATGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 593117: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5931171397387W84930SWAMCA1083SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 13:6:53 on Sun 19 Nov 117.