EST 600040 is a singleton


Sequence

>600040 (1 EST) Length=230 GAGAAACAGCTCATAACTGGTGTATTTTTGCATCAGATACAAGCCGACACACAGATGGATGGCAGTGCGTGCATGTTTGT ATCCATGCATCAACAGCTCAAAGGACCTCCTATCACGAACTGGGCGCAAGCAGAAGTTGAAATCAGCTCTTATGCGAAAA ATTATCGTCTCTCATAGAGAAGAGTGCATAGCTCTTGCGCAAGAGCTCATCATCATGAGATCATTCCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600040: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000401416463W91783TEMFCA0037SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:18:21 on Mon 20 Nov 117.