EST 600049 is a singleton


Sequence

>600049 (1 EST) Length=197 ATCATGATACACATGATCCGATTGTAGATCAGATTGCAGGATCTATAGTGAGACGACTAGGATATCTAGATCAGCAGTCA GTCAGGATACGGAGGATCGATGCAGAAGTAGCATCATGCGATGATGATAGACTCACATATCGATCAGTATTCATCTCAGT CACTGGATCCGAACCGCTGAACTAACGATCAAGGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000491416472W91805TEMFCA0060SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:29:4 on Sun 19 Nov 117.