EST 600054 is a singleton


Sequence

>600054 (1 EST) Length=108 AAGGTTGGAAGCGAGTTAAGGAAGACGAGTTAGGAAGTCTCGTCTCAAAGAAATATCAATCNTGATATATAGCTGATCTT AGGTTAGNTTAGTCAGTTTCTAACTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600054: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000541416477W91810TEMFCA0079SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:31:30 on Sun 19 Nov 117.