EST 600057 is a singleton


Sequence

>600057 (1 EST) Length=126 AGCCACTGNACGACTCAGAAGGTTCGGACTGAAACCCAATCGAAACACCCATGCCACACCGCCACGCTCTAGCCGTTGAA GCCACAGCATGTAGTCACGGCCAACTTACGTAACTGCGCATAGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600057: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000571416480W91813TEMFCA0085SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:23:15 on Tue 16 Jan 118.