EST 600075 is a singleton


Sequence

>600075 (1 EST) Length=369 CGGAGGGCTAACTCTACTGAATTTTACTACTAACACTGAACTCCAGCTTTTTATTGGATATTGATTGATCGTCGGGTGAT TTTCGAGGATATATCGAAATGATTCCGGCTAATTCTAAACGGAATATTAACCCGACACATAGTGACATTAAAAATGCTTT GCCGAGAAAAAATAAACGGACGGGATTGACCGATCTGAGCAATGCCATCAGCTCAACTTTACATATTAGTTCACAAGTCA GCGACAATATTGAAAAGCAGAATATCGAAAAGCCCAGGAGAGTGCACCCCGTTGTCCGAGCTAAGTCTGAAGAGAGAAAA TCCGTGCGTATCAATGAAGCACNGTATGAATCTNATTCGGANAGCCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000751416498W91792SWAMCA1043SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:2:54 on Mon 20 Nov 117.