EST 600077 is a singleton


Sequence

>600077 (1 EST) Length=199 TAAATTTGAATAGCAGCTGCATTTCAAAGCTAAGATGAGCTTCCTAGTCCTATTATTTCTGGCTATTATAGCAGGCCTTG CAGCAGCTTATTATACTGGTCATTTGGATTCATACATCGCTCAAATTCAACAGAAGGCGAAACATTGACAAACTGATGGC AAATCAACAAAGAATGTTTATAAATTAATATAGAAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600077: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000771416500W91794SWAMCA1045SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:23:45 on Sun 19 Nov 117.