EST 600088 is a singleton


Sequence

>600088 (1 EST) Length=252 ATTGTTCTGTGGCTTGCTTCCTTGGTGTTGGTTCGTATTGTACATTCTGAACCATTTAGGGATTGTGGATCTAAATTTGG AAAATTATATTCACTAACTGTAACGCCATGTGACAGGACACCGTGTGCGTTATATAAAGGTCAAAACGCTACTATTACAA TTGAATTCACTACCCAAGAGACTGTAAAGGATGGTCATATTTCTGTACATGGAGTTATTGCACATGTACCAATACCATTT GCACTTGACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 600088: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6000881377929U58052SMU58052Schistosoma mansoni adult worm Lambda ZAP II library


Date: 10:4:42 on Fri 24 Nov 117.