EST 600118 is a singleton


Sequence

>600118 (1 EST) Length=313 CACGAGCAAGAAGGTCACATTGAAAAAAGCAAACATTTAACATTTAACATGGGTGCCAGGCCTGTGATTCTATTTCTACT CATTTTAATTGGCCTCGGTGTTGCCTATCACATGGGAATTCTGGAACCTTATATTAAGGAAGCTCAGGCACGAATGAAAC AGGGTGGTGGTGGTGGACCTCAATAAAGGCTCAAAATACATAAATCCGAATCGAAGAACAGGAACCGATCAACTTATCTT ACTACAAGGAATATACGTACATATAATATATACTGACTGATGTGATACATTCATTACTTAATTCGCTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 600118: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6001181420956W91842RRAMCA196SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:31:36 on Wed 22 Nov 117.