EST 600120 is a singleton


Sequence

>600120 (1 EST) Length=291 AGGTTTGAAGAGTGAAAGATTGGGAAATCCCGAATGAAAATAATTTACATTTGTGGCAAACATTAGTGCACTTATCAATT CTGGCTTAATGTCGAGAATGATCGAAATCAGGATGGGACTATAAGGGATGTTGACAGTATGTCAATAAGCGTAGGACATT AATGGTATCTGGAAAAAATGGACTTCTTTAGTGACGACAATACTCATTAGATTTTCGAACTGAAATCAAAAAAGAACCAA GCGACTTTTAGGGACTGTTTCAAGAGTGATCGGAAGTAAAGCATATATATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 600120: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6001201420958W91844RRAMCA199SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:24:37 on Fri 24 Nov 117.