EST 60711 is a singleton


Sequence

>60711 (1 EST) Length=402 TTCTTTGTTGTTTGAATCATTCCTCTGTTCAATATTTAACATTCAACTCATAATACATTAGGAAATAATGGCTACTGAAA GTCTTCAAGCTCGACTGACTGATTTCGAGCGTCAAGCACGTGGTGTATGTATAGGTGTGAATCATTTAGCGCTTGACAGT GAACGTGTTAGACAAGCTGAATTATTACAAAANATTATACAACTGGANNNCGGTATTCANCAATCGAGTGCACAAAACTC CCATTTACCTGAAGCAGCAGCTGAGATTCGTGATGATGTGAAGAATAATACATCGGCATTACGTTACTTAGAAACAATAT CTCAATTGGNGAATTCATTTACAGTTCTAACAGAAAATGTCACTGAAACTTCTGTACAACTAAGTGCACCTAAAGNGTTA AA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 60711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60711529741T24138SMEST0336Schistosoma mansoni, adult worm, Gloria Franco


Date: 16:45:48 on Sat 18 Nov 117.