EST 60717 is a singleton


Sequence

>60717 (1 EST) Length=187 GGTGGTTGTGCAATGGCTAATCGTTTATGTAAACATTTTGAAAAGAATGANGTTGCTGTTATAGAGCCCTCTGCAACTCA TTATTATCAACCTTTATGGACACTTGTTGGTGCTGGCATTAAACCTTTAAAAGAATCAGTCCAACCTTTAGAAAAAGTTT TAACATCAAANGCCAAATTGTATAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 60717: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60717529747T24144SMEST0342Schistosoma mansoni, adult worm, Gloria Franco


Date: 8:24:56 on Wed 22 Nov 117.