EST 60718 is a singleton


Sequence

>60718 (1 EST) Length=216 AAAGTGAAATCATATCAGTCTAATTGTGTAAAATTGATTATACAAAGAGTATATGTTCATTTTACATACTTTGGGATGAA AAGTTACCAATTTTTGAAGTTTGAAAATAAATGTACACGAATGAAGGAACACGCAACAGGATAATATTCTTCACACTAAA TGAGGCATCTGTATAAAATCCAACCGGTGAATCAGCTAAGGCTTTCGACCAAGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 60718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60718529748T24145SMEST0343Schistosoma mansoni, adult worm, Gloria Franco


Date: 7:14:18 on Mon 20 Nov 117.