EST 60723 is a singleton


Sequence

>60723 (1 EST) Length=236 ATCGGTCGTGTTCTGGTTTACGATAGTNATGGGAATCGTAACAGCTTTGTGCTAATGCATAATATGCATTTGAATACACA TTTCGGCTTACAGATTTATACCCCNNCTCCTGTTGTGTAATATGTNCTATACCTCAAAGTTACTGTGATGGATGTAGNTC AACAAATCACGTACAATTCAGATTTAGCGNAAGTTTCTTAACCGAGTCTGGATCTATTGCCTCTGCAGTATATAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 60723: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60723529753T24150SMEST0348Schistosoma mansoni, adult worm, Gloria Franco


Date: 0:47:25 on Thu 23 Nov 117.