EST 618605 is a singleton


Sequence

>618605 (1 EST) Length=409 TACATTTTGCTAATCTTTCAAATTTTAACAATCCAATCTGAAAACAATTTTAAATTTTTTATTGAGTAAACAAATGTCTA AACATAGTATTAATTATAAACGTAATCGAAGGAAACCAAAATGGTCTAGTCCAGGTGGAACACCCGGACCATATGGTCGA ATTCGACAAAAACAAGATTTCATTGATATTAAGAAAGAAATTGAGAAGTTAAAACGAATTAGTCGGAAATTAAATAAGAC TGAAATTAACAAGAATCAATGGAAGGAATGGAATTAAAATCTTCATCTAAATTATTTGAGTTATAATTTAAATAAACAAA CACAAAATGAAATGCATTTTAATGCATTATTTGAGCAGAAAGCGATGAAATAATGTTAATTGTGCTAATGTTACAAATGT TAATCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 618605: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186051463706AA007701SWAMCA788SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:29:37 on Mon 20 Nov 117.