EST 618613 is a singleton


Sequence

>618613 (1 EST) Length=473 GACAAACTAGGGAGGATGATGAATCTATGTTATAGTTATTTATATCGCTGTTGTCTTTCTTATTTTCACAATTTAATCAA GTTTTTCTTGTAGCCAGTGTACTTATATTTTAGTCAGTGTTTGTGCTCGTGGTGTTCAACTTTTTGACTTATGCCGGCCA ATTCTACTTATGTATAATACACTATAATTTTGTCATTTTCTTTATGACACCCTAAACGTTTTTTTCTTTTCTTTTTTTAA TATGGATTTCCACTATACTTTTTATAGGAATATTACATATATATAAACTCTTGCCATAGTATGAACGTATCAGGGCGTAA TACTTTTTAAATTTTATTGGGAAAACAGTTAAAATGTGCTTAAAAGANTGAAAACATTGTTATCCTTCTATAATTAATTG CTTTCCTGTTCATCCACCATGACTTTTAACAATACGCAGCAATATAATCATGGTGATAAGCTAAAATATCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 618613: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186131463714AA007709SWAMCA801SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:0:37 on Tue 21 Nov 117.