EST 618614 is a singleton


Sequence

>618614 (1 EST) Length=488 AAAACAAGCTAAAACCGTATCTACCAACTTTTCATATTTTGTAAATGAAGTTGAATTTCGAATTAACGATTAATAGCTCT CTTTCATTATAGATTTTTCACATTTACCTTTTTAGAGATGGTGTTTTAAAGCACTCACAAGTGACAACTAGAAATATGTC TCTGGCTGTATCAGATTGCTTCTGGAGAATGGTGAAAGACTCAATCGAATCACAGGCCGATGCATTTCGTGCAACACGTT TCAATCTTGAAACTGAATGGAAGAATAAATTTCCCCGAATGCGTGAATTGGATCGTGATGAATTATTTGACAAAGCAAGA GGTGAAATACTGGATGAAATAGTCCCTTATCACTTGTNCCAGCAAAACGATGGGAAAAATTGTTGAAAAAGAGGCTATGG GATGCAGTANCACCCATATCTTTGATCAAATTTTAATGCCCGCTAGTGCTGTTGACATGCGGTTCCTTTAATACATTGGT AGATATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 618614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186141463715AA007710SWAMCA802SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:15:7 on Thu 23 Nov 117.