EST 618616 is a singleton


Sequence

>618616 (1 EST) Length=459 GGNCGCCGGGCTGCAGATTCGGCACGAGCAAGTTGANAACGAAGTGTGGAAGCTAAACAACCATAATGTACAACAAGTGT CCATTCAAGAAGAATATTGATACAAGCAGANAAGACGAGAACGCATTGAGAATGAGAATGTGAAAGAAAAGCTAAGAAGC ACGCACCGATGTGCAGGTGGGACAAACGTGAGAAATACGAACAGTATGCTATGAAGTTCGGANACTGTTGAATCGGCAGA TATTATTATGAGTGCTCGATGCGCGAGATCCGTAGGATAAACAGAATGTCGAAGAAGTGTTGACGCAGAACACTGTTGCT CTAACAGATGACTGTACGAAGAATGTAAATGCTGCGTATTGCGCAGCATGCACTATACTTCAAGCTCACTCAGAACGATC GTATTGGACGTTCATCTCCATTGCATCAACTCAATTTGGCGACGTAGAGCTTGTATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 618616: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186161463717AA007712SWAMCA804SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:21:19 on Sun 19 Nov 117.