EST 618620 is a singleton


Sequence

>618620 (1 EST) Length=462 GGAAGCCGAGCCAGAGTTCTCTTTTCTGGTTAAGGAACGGACTCCCTGGAATCGGTTCAGCCGGAGATAGGGATGTTGTT TCCGTAAAGCGCCACGGTTCCTGTGGTGTCTCGTGCGCTTTGTTCGATCCATGAAAATCCGAGGGAAGCTATTTGAATTT CGTGCCAGATCGTACCCATATCCGCAGCAGGTCTCCAAGGTGAACAGCCTCTAGTCGAACATCATTTTTGATGTAAAACC GTGGGATGATTCGATTGAAATACCGATATCGAGAAGAGTATAAGAACGATCGAATTGGATGGGCTTGTATGGGGAGCAAC AAAATTTTGCCCGTGGCTTATGGCATAAAAAAACTTCCAATCTGTTGTGTTGTGGAAGATGAGAAAGTATCCTCAGATTG GTTAGAACAACAGATTATGGGCTTCGATAATTAATGCAATCCGTTGACATTGTAGCTTTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 618620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186201463721AA007716SWAMCA818SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:9:45 on Thu 23 Nov 117.