EST 618635 is a singleton


Sequence

>618635 (1 EST) Length=334 AAACCAATCAGATTAATATACATTTTAAGTCCGTCGAATNAGAGACTCTAGATAGCTATGCGNTGAACCTCATCGGATCT TGTACCGAGNAACGTATCAATGCAACTTGTCAGCCTTACTCGTCTTCTCGATTGTACTGTATATGCCCTACCATGACTTG TCAACGGAGTCANGGAGAACATGGGTTCGACTCCGGCATACGGAGCCTGCAGAATCCGCTACCACAATCCAAGGAACGGC AAGCAAGGCCCGCAAATGGACACCACTCTCCAAATCTGAAGGAGGTATCCGACACAAAAATACCGAGACCGTATCTCTTC TGAAGGGCCGGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 618635: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186351463736AA007731SWMFCA407SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:35:32 on Tue 21 Nov 117.