EST 618639 is a singleton


Sequence

>618639 (1 EST) Length=473 ACGAGACCACNTCACTTTCGGAGTGGATATTGATGAANTTGTTCGTGAAATGCGATTCAGAGTANAACAAGCAGTGGGTT TAACATGTAGTGCAGGAATTGCGCCAAATTCTCTGTTAGCTAAAGTATGTTCCGATATCAATAAACCGAACGGGCAGTAT CGTCTGCTGAATGAAAGGGAAGCCGTTTTAACTTTTTTGAAGGATCTTCCAATACGTAAGATAAGCGGTATTGGGCCTGT AATGGAANCAGTTCTAAAAGGGATAGGTTTGGAAAAATGTGTTGACTTCTATGAGCGACGCGGAATAATTAGTTTGCTTT TTACACAACGCAGTTATGAATATTTTTTGCGAATTGCTCTTGGTATATCTCAAGTGTCAGTGCTGATCCAAAAATGAGAC GGAAAAGTATCAGTACAGAACGAACATTCCATCCTACTGGGAGACCTTGGACTCTTCTCGAGACGTTGGAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 618639: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186391463740AA007735SWMFCA413SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:25:48 on Mon 20 Nov 117.