EST 618643 is a singleton


Sequence

>618643 (1 EST) Length=191 GAGANTCCNGATGTGNATGTCCGTTAGTCATCCTGCAGTAAGAANCTGATGATGCTATGATAACNCAATACNGCACACTC GCAAACCGANACCCGTGGAGAGGTGTCAGGAACTGACATATACGTACTCTTGGCCGCTCCGTTTATGGTCGAATGCTAAA TTAGGGAGTCTANAAATGGAGTCAGANNNTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 618643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186431463744AA007739SWMFCA420SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:9:12 on Sun 19 Nov 117.