EST 618649 is a singleton


Sequence

>618649 (1 EST) Length=443 GTCTAACGAGACTAATGAATTGTCNCATGTACAACGGAAATTNCNGCAGACGAGCAACGAAATGTTNACNTCCGGCATGG NAACCTTTACAACAACGAATGAGTGGTTGTCTGTTCACCTTGGANCCATATGTAGTTAATGATAGCGCATAGCGAANTGT GTGTNAANAGCTCCGATGTTNGATTNGAAGTACNTGNGTGNAATTTTANTGTATCTGCTATAGAGATGTGAGATATNNAA ATTCTGCTAATCCGTCGAATGATAACATCATGTATGCAGATGCAGATATTTTGAGGATAAANATCGAGATGGATATGGTA GCCANATACATAGTGGTACCTCATTGTATATGCCATGATGGGAGTACTAAGATGATGACGCANACTGTCTGTATGTTGTC ATCCTGACCCCGTTGCAGTCANCTCCCCCAGAGAATCCTGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 618649: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186491463750AA007745SWMFCA430SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:56:25 on Mon 20 Nov 117.