EST 636354 is a singleton


Sequence

>636354 (1 EST) Length=217 AAACATACTGTTACTAATACTTTTTTCTTGTCACGTTCATGAGGACCAGTGACTCTAAGGATTTGGATTCATTAGATGTT TAGCTGATAATCAGTACTTGTTCTACATTAATTTGTACCTGAAATGGATTTTCTGTAATAAATGGAGAAAAAAAAAAAAT CNTTTAAACAAATTNGGCAAATAATGATNATTCNAAATGGGATNACTACNGCTATNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 636354: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6363541486119AA022337SWMFCA453SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:23:9 on Wed 22 Nov 117.