EST 636356 is a singleton


Sequence

>636356 (1 EST) Length=369 CCTGCCTGAAAGGAGCCGAGACAACAGATTTTCAACAGCAGGATGTGGGCGTTTAAGTTTCTGCTTCTACCCACGGTGAG CTTTGCTCTGTACCCTGAGGAAATGCTGGACTCGCAGTGGGAGCTATGGAAGAAGACGCACAGGAAGCAGTATAACAGCA AGGTAGATGAAATCTCTCGGCGTTTAATTTGGGAGAAAAACCTGAAGCAAATTTCCATCCATAATCTTGAGGCCTCTCTC GGTGTCCACACATACGAACTGGCCATGAATCACTTGGGCGACATGACCAGTGAAGAAGTGCTTCAGAAGATGACTGGACT CAAGTTACCACCCTCCGGTTCCCACAGTAACGATACTCTCTACACCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 636356: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6363561486121AA022339SWMFCA455SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:33:9 on Sun 19 Nov 117.