EST 636379 is a singleton


Sequence

>636379 (1 EST) Length=332 CTAGCATCTTATTTTTTAAAATATAAAATTTTGTAAAACATTTACAAAATTGGTCTGGAATAAAATGAAGCCTCAGTTCA CGGTTTTGTTGTTTAAAGTAGCTTTTGTTCACCTTCTCGTAAAATCTTACAACCTGCCTTATCTGCAGCAACAATTAATG AATTTAATTGTGCACTATGAATTAACCAACCATTACGAGATCGTTGTCCACTTACTGGGAAAATTACCAGTGAANAAAAG CTTTGTTCATTGATTTGAAATGGATTTGTTGTTGGCAGGTTATGGAATATAAAAATAAATGTCTTTTCGATAGATCTCAC TACTTTTCATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 636379: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6363791486144AA022362SWMFCA486SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:3:44 on Fri 17 Nov 117.