EST 636391 is a singleton


Sequence

>636391 (1 EST) Length=325 CTGACGTGGGAAAAGCTGGAGCTGAAAGGGAATTCAAAGGCCTTGGTGACTGCCTTGTTAANATCTACAAATCTGATGGG ATTAAGGGCCTGTACCAAGGCTTTAATGTGTCAGTACAGGGAATTATCATCTACCGAGCTGCCTACTTTGGCATCTATGA CACTGCAAAGGGTATGCTTCCANATCCCAANAATACTCACATCTTCATCAGCTGGATGATTGCTCAGTCTGTCACTGCTG TTGCTGGCCTGACTTCCTATCCTTTTGACACAGTTCGCCGTCGTATGATGATGCAGTCAGGACGCAAAGGAACGGATATC ATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 636391: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6363911486156AA022374SWMFCA501SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:36:31 on Thu 23 Nov 117.