EST 636414 is a singleton


Sequence

>636414 (1 EST) Length=414 TACACATGCGTGAATATACGATTGATCGAGCTCGATGAGCAGTAGTGGAGGTATATTGGCTGATCGTAACCGACTTTCAT CACAGTCATCAACATCATCAGCTTGTCGTAATTCGCTAATTCCTCCGGAAAACGTTATCAACGAGTCGGAATTTCCATCC TTGGGGGTTCGCTCCTCACCATCCTCAACGTCCTCTACATTTAATTCATTGCCGACCACCAGTAATTACTCCTCACCATC TGTACCACAAAACCATCTTTATTCAAAAGACGTCTACAATGCTCTACAGCGAGCCCCTTATGCGAATNTGATGCGAACAA GTTGATGGGAATTCCGTTATCGACACAGAACGTCGAGTTCCGTATCCAGAAATGAGGACTTTCCCTGCTTTGCCTGGTGC CAATCCATCTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 636414: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364141486179AA022397SWMFCA535SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:1:45 on Wed 22 Nov 117.