EST 636418 is a singleton


Sequence

>636418 (1 EST) Length=375 GAAAAACGAAGAGAAAGATAATAATGAAAGATTGATTAAAGATGTGGCGTCCTCATCTGTTTATTCGACATTATTAACTA ATCAGAAGAAAATTGACTCCTTATTGAAAGTCGCAAGCATGAAGCTTGAACAAAGAAGAGCTCAATTCGAAAAANTANAG CTGCAAGAGGAGAATGAACAAGCTCTCCAGTTGAGGGCAGAAATTGAACGACTGAAGGCAAAATTAATTGAACTGGAAAC AATGGGTGGAATAAAGCAGGTCANCGGTATTCCGGTGTTTGANAAAAGCTTTCTTGTGAAAACTAATAATGATCTAACTC CATCCGTCCAAATGGGAAAAGTTCGAATGAACAGAATGTTGAATGAAGTTGAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 636418: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364181486183AA022401SWMFCA562SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:18:57 on Sun 19 Nov 117.