EST 636422 is a singleton


Sequence

>636422 (1 EST) Length=193 GAAATAGTCTCGAGTTTTTTTTCTTTTTTTTTAANAAAAGCAAAAAATAANTGTAAAAAGTGAAANAAACAAGCTTTAAA TATAAACGGAAAATNCTTTTATATATTGGAACANAAAGTGGCAANCATATANCCTCCTGAATAAATNCACTACTTTTTAC AAATTAAATGGGCAGCAAATTAATAACAGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 636422: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364221486187AA022405SWMFCA567SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:51:56 on Mon 20 Nov 117.