EST 636442 is a singleton


Sequence

>636442 (1 EST) Length=378 GAAGAGAGAGAGAGGGGTTGGTANAGATGAAGAATTAGTTCGAATAAAAATGTAGTACTGCTTTTTTGATGTGGTTGTGG AAAAAGGATACAGTGGTAATAAGAGTGATTCAGCTGACAGCTAATTAGGAGGAGGAGGAAGAGAACGGACGAGGACGAAG CGAAGGATTCGAACGGTGGTTCTGTGGGGATGTGAAGTGTGGAAAAATGACAATTGTCGTTTTCCTCATCGATTCCAGTG CCTCGATGGCTCAAAAAACGTNTCAGGGCACCGCGATGCTGGATGTAGCTCGGTCTATTGTTGAATTGATCCTCAAGGTA ATTCCATGCCTGCTGTTTACTCCATCCTTTCTCCACAGTTGTTGATTCCAAAATGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 636442: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364421486207AA022425SWMFCA591SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:48:59 on Sat 18 Nov 117.