EST 637885 is a singleton


Sequence

>637885 (1 EST) Length=437 GCTGCACGCGCGCTACACTGGAGGAATCAGCGTGCTGTAACCATTATCGAAAGATATTGGTAACCCCTTGAAAATCCTCC GTGATCGGGATCGGGAATTGCAATTATTTCCCTTGAACGAGGAATTCCTAGCAAGTTTACCTTGAAAAAATTAGAGTGCT CAATGCGGGCTAATGCCTGAATACTCGTGCATGGAATAATGAAATAGGATCTCGGTTCTATTTTGTTGGTTTTCTGATCT GAGATAATGGTTAAGAGGGACGGACGGGGGCATTCGTATCGCTGCGTGAGAGGTGAAATTCTTGGACCGTAGCGAGACGT ACGACTGCGAAAGCATTTGGCAAGAATGTCTTCATTAATCAAGAACGAAAGTCAGAGGTTCGAAGGCGATCAGATACCGC CCTAGTTCTGACCGTAAACGATACCACTAGCGTTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 637885: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6378851488484AA023868SWAMCA1069SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:53:36 on Fri 24 Nov 117.