EST 646258 is a singleton


Sequence

>646258 (1 EST) Length=374 AGAGAGAGAAGACTAGTCTCGCTCTCTCTCTCCTCGTGCCGAATTCGGCACGAGNNNNAAGTTTGAGTGCTACAAACTAC TGACGATGAATCTGACAGTACTCAGTATTCTACTTATTACGCTGTTCCACCAACAATATTTCACCCAAGCAGCACCTCCT CCTTTCGTTGGATCCATGAATCCGTATATGAATGTATTGGGATCAGATGCCGACGGTTCATTGCCAAATGGAGATAAAAA ATTATGGAAGCGAAAAGTAGAGGAGCCATTTCATTTGGCTCATTTAAGATTTGGATGAAAACAATTAACCTGTCATTCTG TTTTATCAAAACATATTTGATACTTTTGACTATTGATAGATCATATGCTACGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 646258: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6462581502088AA032116RRAMCA151SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:21:6 on Mon 20 Nov 117.