EST 646265 is a singleton


Sequence

>646265 (1 EST) Length=323 CAGTACATNTTTTTCAAGGTCCATTTTTTTCAGTAAGTTGAAAAATTTTTGAAATTTCCATATTTCTACATTTAATAAAA TCCAACACTATCATATCTTAAGATAGGCTAATATTATTAATAGGAAAGAATGAAAATTAATATTAATTGCAATCAAAGAA ATAATTATTTGTTAATACAGTTCATTCATTTTATAACTAATCGCATTTTTTCACTGTAAACAATCCTTTCGCTCTTTTTT TTAATCAGTTTATATCATATCAAGATATCATATCAAAAGATTATCATGCCGTACATCAGTTCATTTGATGAATTTATGAT GTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 646265: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6462651502095AA032123RRAMCA185SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:33:38 on Sat 18 Nov 117.