EST 667611 is a singleton


Sequence

>667611 (1 EST) Length=370 GGCGGTTANNTGCTTGTCTCAAAGGCNAAGCCATGNATGTCTAAGTTCAAATAAACCTATANTGGTGAAACCGCGAACGG CTCGTTCGATGTCCCGTTGGAAAGNAAATAAAGCCGGAACAGCGTTTTATGCTGTCGTCCAATGATACCCGTGACCCTAT GCCGGTCGGGNACGTTCATCGACACTCCGATNCGNTANATAACACACCATATACTGAACGGTCATCATTTCAACAACAAT CACAAACAATGCCATTTTCATCTTATACACAGTTATCAGCAACAATCACAACTTATCACAAAAATCAGCAGTCAGCCACA AAATGCGACCATTTCATCATTATCAAAGTTATCATCAACAGTCACAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 667611: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676111537091AA051924SWMFCA547SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:24:22 on Fri 17 Nov 117.