EST 667612 is a singleton


Sequence

>667612 (1 EST) Length=490 GTTTGAGCTGTGAAGCACCATAATTAATAGATCACATTGCCATTGTCATTGGACGCTCTAGATTTATTTTATTAATTCGG AAGCTTGTTCTCAATGTCTTCCAAACCTCCATATAAAGTTGCTGATATAAGCCTGGCCGAATTTGGACGCAAGGAAAATA CGATTGGCTGAAAATGAAATGCCTGGTTTAATGGCGATGCGCAAGAAATATGGGTCACTGAAACCGCTGAAAGGAGCCCG TATTGCTGGTTGTTTACATATGACCGTTCAAACTGCTGTTCTGATTGAAACATTAGTGGAACTTGGTGCTGAAGTTCAGT GGTCGTCATGTAACATATTTTCAACGCAGGATCATGCCGCACTGCTATAACCAAAACAAGGTATTCCTGTATATGCGTTG GAANGGAGAACAGAAAAATTTGAATGGTGTATTTACAGACGTTGAATTAATGATGATCAGTACTTGATATGATNCCTGGA TGATGAGCNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 667612: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676121537092AA051925SWMFCA548SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:9:2 on Sun 19 Nov 117.