EST 667614 is a singleton


Sequence

>667614 (1 EST) Length=520 TGGTTGTATTAAGAATAATATTACTTATTTTTAGTTTATTTAATGTGTAATTTTTTGTTCACTGGTAGTTTTTTGATTGT TTTATAAGTGTTCCAGAATAATCGGCTATACATTTTAATTTTTAACTCTATTTGTTGTTTTGTCTTTTTTTATTTTTATA TTTTTATGTTATTTTTGTAAAATGTTTTAGTTTTTTTTATTATTTGAAGANANACAATTAAAATTTGGTTTTTGAACTGG ATTAGTACCCAGGTAATCAAAATTAATTAATTCGGGAGTAAAGTTTTATTTAAACCGAAAAAATATTGACTGACTTTGGA TTTTTCCTTTGGAATATGCGTATGGAGNAACCCTCCTTTTTAGTTAACTCTATTGGCACTTGGAAATACATTACCAAGAA ATTGCAAGGGAAAACCGTTTTTCAACGAANTTATGGGTTATATGTCATCTGGCACCTGTAATTGCCATGGTATGGGAAGT CCTGANGTTATTAACAGCACNNACAATGCTTGGCGCNNAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 667614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676141537094AA051927SWMFCA554SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:31:36 on Wed 22 Nov 117.