EST 667623 is a singleton


Sequence

>667623 (1 EST) Length=410 AATTGACCAACTGATAAAGAAAAGCAGTGTCTAGGAGGGTCGCTTATTGTAGCTACAAATAAAAGAACATGAAAATTTGC GCATTGCATCAATCAGGAAAGCTTCTGCTTAGTGAACAGTTGAATTGTGCAATGTGTTGATCGAGCAATACAACGAGCTG TTGATGTATCAGAGCTGATATATTCGGTTATCACTGATGATAACTTGAAAAGGTCGAAATAGGCAGCAGATAAATGGATT TAGCGAAACTTATAAGCTTAAATGTTGCTAACATCGCATCAGTGCGAAAGCAAATGAAACTTATTGCCCCCCGCCAGTGG AAAATTGAATGCATTGGAAAGTATTCCCCAACATAGAAGAACATCGTTACTATTGATGAATAACCACATGCAGATTGGTA GCAGCAATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 667623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676231537103AA051936SWMFCA708SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:7:39 on Sun 19 Nov 117.